Prev. |  Human A to Z list >  O >  OPA1 > 

ARi80B10 - NRCD Human cDNA Clone

This clone has been withdrawn.

Catalog Number HKR192034
Clone Name ARi80B10
Clone info. Plasmid clone of human OPA1 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GGTGCTGCCCGCCTAGAAAGGGTGAAGTGGTTGTTTCCGTGACGGACTGAGTACGGGTGC
Sequence, submitted(3) n.a.
 
Sequence, refered NM_015560.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) OPA1 (NCBI Gene 4976)  other clone of OPA1 in our bank
Synonyms BERHS|MGM1|MTDPS14|NPG|NTG|largeG
Protein Name OPA1 mitochondrial dynamin like GTPase
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Availability
HKR192034 ARi80B10 This clone has been withdrawn.

How to cite this biological resource

Materials & Methods section:

The ARi80B10 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR192034).

Sequence information

Full length sequence and restriction map are not available.

References and tips

Featured content

Reference


2023.06.06

NRCDhumcloneList_AR_2023May03.csv - GNP_filter3_NRCD_html_230606.pl