DNA Bank Top |  KEGG KO K17079 > 

RIKEN DNA Bank Human Resource - OPA1

Gene ID NCBI Gene 4976 |  KEGG hsa:4976
Gene Symbol OPA1
Protein Name OPA1 mitochondrial dynamin like GTPase
Synonyms BERHS|MGM1|MTDPS14|NPG|NTG|largeG

Link

Ortholog resource in our bank

  OPA1


External database

human OPA1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB17747 pN1-OPA1(123Nt)-Halo Halo Tag, Mitochondrial intermembrane space localization    
RDB17736 pN1-OPA1.123Nt-pHlu pH measurement, Mitochondrial intermembrane space    
RDB17732 pN1-OPA1.full-pHlu pH measurement, Mitochondrial intermembrane space    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030781 IRAK076P21 pBluescriptR BC043443 NM_130836 Full/var
HGX066429 IRAK166B05 pCMV-SPORT6 BC075805 NM_130834 Full/var
HGY028705 IRAK071M17 pBluescriptR BC035393 NM_130837

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR444118 RBdS110E22 pGCAP10 NM_015560.2 done
GAGTGGTTGTTTCCGTGACGGACTGAGTACGGGTGCCTGTCAGGCTCTTGCGGAAGTCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl