Prev. |  Human A to Z list >  A >  ACAT1 > 

ARi68G05 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR187349
Clone Name ARi68G05
Clone info. Plasmid clone of human ACAT1 cDNA with SV40 promoter
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) GAGTCTTCGCCTGTGGAGCCGATACTCAGCCCACTGCGACCATGGCTGTGCTGCCGGCAC
Sequence, submitted(2) n.a.
 
Sequence, refered NM_000019.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) ACAT1 (NCBI Gene 38) finder other clone of ACAT1 in our bank
Synonyms ACAT|MAT|T2|THIL
Protein Name acetyl-CoA acetyltransferase 1
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Catalog # Clone name Availability
HKR187349 ARi68G05 This clone has been withdrawn.

Sequence information

Full length sequence and restriction map are not available.

References and tips

Featured content

Reference


2017.10.27

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_171016.pl