ARi68G05 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR187349 Clone Name ARi68G05 Clone info. Plasmid clone of human ACAT1 cDNA with SV40 promoter Vector Click for information pGCAP10 5'-terminal sequence(1) GAGTCTTCGCCTGTGGAGCCGATACTCAGCCCACTGCGACCATGGCTGTGCTGCCGGCAC Sequence, submitted(2) n.a.   Sequence, refered NM_000019.2 (NCBI RefSeq mRNA) Gene Symbol and ID(3) ACAT1 (NCBI Gene 38)  other clone of ACAT1 in our bank Synonyms ACAT|MAT|T2|THIL Protein Name acetyl-CoA acetyltransferase 1 KEGG

Links   NCBI Gene   NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Sequence information

Full length sequence and restriction map are not available.

References and tips

Featured content

Reference

2017.10.27