DNA Bank Top |  KEGG KO K00626 > 

RIKEN DNA Bank Human Resource - ACAT1

Gene ID NCBI Gene 38 |  KEGG hsa:38
Gene Symbol ACAT1
Protein Name acetyl-CoA acetyltransferase 1
Synonyms ACAT|MAT|T2|THIL

Link

Ortholog resource in our bank

  ACAT1


External database

human ACAT1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14697 pSpCas9(BB)-2A-puro-ACAT1 sgRNA Expression vector of sgRNA for targeting human ACAT1 and Cas9.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056460 IRAK141C12 pCMV-SPORT6 BC063853 NM_000019 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014344 W01A035O08 pENTR-TOPO IRAK141C12 BC063853 NM_000019  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR071376 ARe78H08 pKA1U5 NM_000019.2  
GGCTAGTCTACGCCTGTGGAGCCGATACTCAGCCCTCTGCGACCATGGCTGTGCTGGCGG
HKR180054 ARi50C06 pGCAP10 NM_000019.2  
TACTTTTCCCCTGTGGAGCTGATACTCAGCCNACTGCGACCATGGCTGTTCTGCCGGCAN
HKR323780 RBb09H12 pKA1U5 NM_000019.2  
GGCTAGTCTACGCCTGGTGGAGCCGATACTCACCCNTTTGCGACCATGGCTGTGCTGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.24

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl