Prev. |  Human A to Z list >   >   > 

ARi59G01 - NRCD Human cDNA Clone

Catalog Number HKR183745
Clone Name ARi59G01
Clone info. Plasmid clone of human SDC4 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GACTCGCCGCAGCCTGCGCGCCTTCTCCAGTCCGCGGTGCCATGGCCCCCGCCCGTCTGT
Sequence, submitted(3) n.a.
Note NM_002999.4:74 T>G (F12L)
 
Sequence, refered NM_002999.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(4)  (NCBI Gene 6385)  other clone of in our bank
Protein Name
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR183745 ARi59G01 DNA solution

How to cite this biological resource

Materials & Methods section:

The ARi59G01 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR183745).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(Insert 5')
Seq File
(Insert 3')
Seq File
(Upstream of poly(A))
Seq File
(contig)
PDF File
ARi59G01a.seq   ARi59G01c.seq   ARi59G01.pdf

References and tips

Featured content

Reference


2023.06.12

NRCDhumcloneList_AR_2023May03.csv - DataSheet_NRCD_html_230606.pl