Prev. |  Human A to Z list >  C >  C12orf29 > 

ARi48H02 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR179370
Clone Name ARi48H02
Clone info. Plasmid clone of human C12orf29 cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GGGGCGCGGAGTGTGCGTGGCCTGAGCCGTGCGGGTGACTGCTTCAGGGCTTCTCCGCGA
Sequence, submitted(2) n.a.
 
Sequence, refered NM_001009894.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) C12orf29 (NCBI Gene 91298)  other clone of C12orf29 in our bank
Synonyms -
Protein Name chromosome 12 open reading frame 29
KEGG hsa:91298
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR179370 ARi48H02 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.11.20

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_180123.pl