Prev. | 

RIKEN DNA Bank Human Resource - C12orf29

Gene ID NCBI Gene 91298 |  KEGG hsa:91298
Gene Symbol C12orf29
Protein Name chromosome 12 open reading frame 29
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY029412 IRAK073I20 pBluescriptR BC035136 NM_001009894 Full/var
HGY099436 IRAL048J20 pDNR-LIB BC058014 NM_001009894 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR179370 ARi48H02 pGCAP10 NM_001009894.2  
GGGGCGCGGAGTGTGCGTGGCCTGAGCCGTGCGGGTGACTGCTTCAGGGCTTCTCCGCGA
HKR279490 ARiS198M02 pGCAP10 NM_001009894.2  
GAGTTGGGGCGCAGCCGCGGTGGCTGGGCGCGGAGTGTGCGTGGCCTGAGCCGTGCGGGT
HKR336830 RBb42B06 pGCAP1 NM_001009894.2  
GGCGCGGTGGCTGGGCGCGGAGTGTGCGTGGCCTGAGCCGTGCGGGTGACTGCTTCAGGG
HKR375632 RBd39B08 pGCAP10 NM_001009894.2  
GGCGGAGTGTGCGTGGCCTGAGCCGTGCGGGTGACTGCTTCAGGGCTTCTCCGCGACTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl