Prev. |  Human A to Z list >  R >  RACGAP1 > 

ARh07B04 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR122828
Clone Name ARh07B04
Clone info. Plasmid clone of human RACGAP1 cDNA with SV40 promoter
Vector plasmidClick for information pGCAP1
5'-terminal sequence(1) GGCTCTGCCGTTGGGTGAGGCGCGGAGCGAAGTGAAGGGTGGCCCAGGTGGGGCCAGGCT
Sequence, submitted(2) n.a.
 
Sequence, refered NM_013277.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) RACGAP1 (NCBI Gene 29127) finder other clone of RACGAP1 in our bank
Synonyms CYK4|HsCYK-4|ID-GAP|MgcRacGAP
Protein Name Rac GTPase activating protein 1
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Catalog # Clone name Availability
HKR122828 ARh07B04 This clone has been withdrawn.

Sequence information

Full length sequence and restriction map are not available.

References and tips

Featured content

Reference


2017.10.27

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_171016.pl