Prev. |  Human A to Z list >  A >  ADTRP > 

ARf07G12 - NRCD Human cDNA Clone

This clone has been withdrawn.

Catalog Number HKR082956
Clone Name ARf07G12
Clone info. Plasmid clone of human C6orf105 cDNA with SV40 promoter
Vector(1) pKA1U5
5'-terminal sequence(2) GAGTCGCCATGACGAAGACTTCTACATGCATATACCANTTTCCTTGTTCTGAGCTGGTAT
Sequence, submitted(3) n.a.
 
Sequence, refered NM_032744.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) ADTRP (NCBI Gene 84830)  other clone of ADTRP in our bank
Synonyms AIG1L|C6orf105|dJ413H6.1
Protein Name androgen dependent TFPI regulating protein
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Availability
HKR082956 ARf07G12 This clone has been withdrawn.

How to cite this biological resource

Materials & Methods section:

The ARf07G12 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR082956).

Sequence information

Full length sequence and restriction map are not available.

References and tips

Featured content

Reference


2023.06.06

NRCDhumcloneList_AR_2023May03.csv - GNP_filter3_NRCD_html_230606.pl