Prev. |  Human A to Z list >  A >  ADTRP > 

ARf07G12 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR082956
Clone Name ARf07G12
Clone info. Plasmid clone of human C6orf105 cDNA with SV40 promoter
Vector plasmidClick for information pKA1U5
5'-terminal sequence(1) GAGTCGCCATGACGAAGACTTCTACATGCATATACCANTTTCCTTGTTCTGAGCTGGTAT
Sequence, submitted(2) n.a.
 
Sequence, refered NM_032744.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) ADTRP (NCBI Gene 84830) finder other clone of ADTRP in our bank
Synonyms AIG1L|C6orf105|dJ413H6.1
Protein Name androgen-dependent TFPI-regulating protein
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Catalog # Clone name Availability
HKR082956 ARf07G12 This clone has been withdrawn.

Sequence information

Full length sequence and restriction map are not available.

References and tips

Featured content

Reference


2017.10.27

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_171016.pl