Prev. | 

RIKEN DNA Bank Human Resource - ADTRP

Gene ID NCBI Gene 84830 |  KEGG hsa:84830
Gene Symbol ADTRP
Protein Name androgen dependent TFPI regulating protein
Synonyms AIG1L|C6orf105|dJ413H6.1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086749 IRAL016O13 pDNR-LIB BC007011 NM_032744 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR186054 ARi65C06 pGCAP10 NM_032744.3  
GCTCTCAAAGCCACATTACTCTCAGAGGGATGGAGTTTTCCATCAGTGAAGAAGGTATTA
HKR248836 ARiS122B12 pGCAP10 NM_032744.3  
GAGAAAGTACTCAAGACATTCACGGTGCCCCGGTCAGCACTCGCCATGACGAAGACTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl