Prev. |  Human A to Z list >  S >  SLC2A1 > 

ARe49A08 - NRCD Human cDNA Clone

Catalog Number HKR059608
Clone Name ARe49A08
Clone info. Plasmid clone of human SLC2A1 cDNA with SV40 promoter
Vector(1) pKA1U5
5'-terminal sequence(2) GAAGAGGCAAGAGGTAGCAACCGCGAGCGTGCCGGTCGCTAGTCGCGGGTCCCCGAGTGA
Sequence, submitted(3) n.a.
Note match to NM_006516.6 (1-2581) CDS:full/var (c.45 C>T)
 
Sequence, refered NM_006516.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) SLC2A1 (NCBI Gene 6513)  other clone of SLC2A1 in our bank
Synonyms CSE|DYT17|DYT18|DYT9|EIG12|GLUT|GLUT-1|GLUT1|GLUT1DS|HTLVR|PED|SDCHCN
Protein Name solute carrier family 2 member 1
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR059608 ARe49A08 DNA solution

How to cite this biological resource

Materials & Methods section:

The ARe49A08 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR059608).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(Insert 5')
Seq File
(Insert 3')
Seq File
(Upstream of poly(A))
Seq File
(contig)
PDF File
ARe49A08a.seq   ARe49A08c.seq ARe49A08z.seq ARe49A08.pdf

References and tips

Featured content

Reference


2023.07.07

NRCDhumcloneList_AR_2023May03.csv - GNP_filter3_NRCD_html_230707.pl