Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SLC2A1

Gene ID (NCBI) 6513
Gene Symbol SLC2A1
Protein Name solute carrier family 2 member 1
Synonyms CSE|DYT17|DYT18|DYT9|EIG12|GLUT|GLUT-1|GLUT1|GLUT1DS|HTLVR|PED|SDCHCN
Databases KEGG hsa:6513 |  NCBI Gene 6513
Featured content HIF-1 signaling pathway - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07299)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07814 pGL4-phSLC2A1 Promoter collection, Human SLCA1 promoter

RDB_org_170226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059608 ARe49A08 pKA1U5 NM_006516.2  
GAAGAGGCAAGAGGTAGCAACCGCGAGCGTGCCGGTCGCTAGTCGCGGGTCCCCGAGTGA
HKR070548 ARe76G04 pKA1U5 NM_006516.2  
GAAGAGGCAAGAGGTAGCAACCGCGAGCGTGCCCCTTTNCTAGATCGCGGGTCCCCGAGT
HKR203341 ARiS008F21 pGCAP10 NM_006516.2  
GACTGCCCTGCATGGCGTCCTTGGAACGGACAAGCAGATCCTTAGGGCTTGCCTCTGCCC
HKR279401 ARiS198I09 pGCAP10 NM_006516.2  
GAAGAGGCAAGAGGTAGCAACCGCGAGCGTGCCGGTCGCTAGTCGCGGGTCCCCGAGTGA
HKR430339 RBdS075O03 pGCAP10 NM_006516.2  
GGGNAANANNTAGCAACAGCGAGCGTGCCGGTCGCTAGTCGCGGGTCCCCGAGTGAGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl