Prev. |  KEGG KO K07299 > 

RIKEN DNA Bank Human Resource - SLC2A1

Gene ID NCBI Gene 6513 |  KEGG hsa:6513
Gene Symbol SLC2A1
Protein Name solute carrier family 2 member 1
Synonyms CSE|DYT17|DYT18|DYT9|EIG12|GLUT|GLUT-1|GLUT1|GLUT1DS|HTLVR|PED|SDCHCN
Ortholog resources KEGG ortholog (KEGG orthology K07299) in the DNA Bank
Featured content HIF-1 signaling pathway - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07814 pGL4-phSLC2A1 Promoter collection, Human SLCA1 promoter

RDB_org_190226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059608 ARe49A08 pKA1U5 NM_006516.2  
GAAGAGGCAAGAGGTAGCAACCGCGAGCGTGCCGGTCGCTAGTCGCGGGTCCCCGAGTGA
HKR070548 ARe76G04 pKA1U5 NM_006516.2  
GAAGAGGCAAGAGGTAGCAACCGCGAGCGTGCCCCTTTNCTAGATCGCGGGTCCCCGAGT
HKR203341 ARiS008F21 pGCAP10 NM_006516.2  
GACTGCCCTGCATGGCGTCCTTGGAACGGACAAGCAGATCCTTAGGGCTTGCCTCTGCCC
HKR279401 ARiS198I09 pGCAP10 NM_006516.2  
GAAGAGGCAAGAGGTAGCAACCGCGAGCGTGCCGGTCGCTAGTCGCGGGTCCCCGAGTGA
HKR430339 RBdS075O03 pGCAP10 NM_006516.2  
GGGNAANANNTAGCAACAGCGAGCGTGCCGGTCGCTAGTCGCGGGTCCCCGAGTGAGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl