Prev. |  Human A to Z list >  F >  FN1 > 

ARe05G09 - NRCD Human cDNA Clone

Catalog Number HKR042153
Clone Name ARe05G09
Clone info. Plasmid clone of human FN1 cDNA with SV40 promoter
Vector(1) pKA1U5
5'-terminal sequence(2) GGCCCGCGCCGGCTGTGCTGCACAGGGGGAGGAGAGGGAACCCCAGGCGCGAGCGGGAAG
Sequence, submitted(3) AB191261 [link]
Note Full cds when compared using AB191261
 
Sequence, refered NM_001306131.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) FN1 (NCBI Gene 2335)  other clone of FN1 in our bank
Synonyms CIG|ED-B|FINC|FN|FNZ|GFND|GFND2|LETS|MSF|SMDCF
Protein Name fibronectin 1
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR042153 ARe05G09 DNA solution

How to cite this biological resource

Materials & Methods section:

The ARe05G09 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR042153).

Sequence information

Restriction map is not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(Insert 5')
Seq File
(Insert 3')
Seq File
(Upstream of poly(A))
Seq File
(contig)
PDF File
ARe05G09a.seq   ARe05G09c.seq   ARe05G09.pdf

References and tips

Featured content

Reference


2024.02.07

NRCDhumcloneList_AR_2023May03.csv - DataSheet_NRCD_html_230707.pl