Prev. |  Human A to Z list >  A >  ACTG1 > 

ARe03B01 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR041225
Clone Name ARe03B01
Clone info. Plasmid clone of human ACTG1 cDNA with SV40 promoter
Vector plasmidClick for information pKA1U5
5'-terminal sequence(1) GCTCAGTCGCCGCTGCCAACTCTCGCACTCTGNTTCTTCCGCCGCTCCGCCGTCGCGTTT
Sequence, submitted(2) n.a.
 
Sequence, refered NM_001614.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) ACTG1 (NCBI Gene 71) finder other clone of ACTG1 in our bank
Synonyms ACT|ACTG|BRWS2|DFNA20|DFNA26
Protein Name actin, gamma 1
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Catalog # Clone name Availability
HKR041225 ARe03B01 This clone has been withdrawn.

Sequence information

Full length sequence and restriction map are not available.

References and tips

Featured content

Reference


2017.10.27

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_171016.pl