Prev. | 

RIKEN DNA Bank Human Resource - LINC00882

Gene ID NCBI Gene 100302640 |  KEGG hsa:100302640
Gene Symbol LINC00882
Protein Name long intergenic non-protein coding RNA 882
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR392058 RBd80C10 pGCAP10 NR_028303.1 No cds done
CGGCCGGCCGATGGCCCTTCTCGGGTCCCCTAGGTCGCGGGGCAGCCGGGGCGGAAGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl