Prev. | 

RIKEN DNA Bank Human Resource - LOXL1-AS1

Gene ID NCBI Gene 100287616 |  KEGG hsa:100287616
Gene Symbol LOXL1-AS1
Protein Name LOXL1 antisense RNA 1
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR075731 ARe89F11 pKA1U5 XM_002343352.1  
GAGTCCCTGGAGTTCCCAGCCAAGCCACAGACCTGCCTCTGAGGAAGGGAATCGAGCAGG
HKR279454 ARiS198K14 pGCAP10 XM_002343352.1  
GAGTTCTAAGGAGGGGCCCGGGGGGCCCGGAGCAGTTTCCAGTGGCCAGGGGTACGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl