Prev. | 

RIKEN DNA Bank Human Resource - CMC4

Gene ID NCBI Gene 100272147 |  KEGG hsa:100272147
Gene Symbol CMC4
Protein Name C-X9-C motif containing 4
Synonyms C6.1B|MTCP1|MTCP1B|MTCP1NB|p8|p8MTCP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR405249 RBdS013C01 pGCAP10 NM_001018024.2 done
GATAACTTCGGTTCGAGTGACCTCGGCCCGGGATGCCCCTCGGCTCACCCCGGGCTCACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl