Prev. | 

RIKEN DNA Bank Human Resource - TPT1-AS1

Gene ID NCBI Gene 100190939 |  KEGG hsa:100190939
Gene Symbol TPT1-AS1
Protein Name TPT1 antisense RNA 1
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE126419 M01C116A19 pDONR221 2_5-A10 AK124332 ENST00000330825  
HGE117205 M01C093A05 pDONR221 IMS10-A03 AK124332 ENST00000330825  
HGE117253 M01C093C05 pDONR221 IMS10-A03 AK124332 ENST00000330825  
HGE117301 M01C093E05 pDONR221 IMS10-A03 AK124332 ENST00000330825  
HGE117349 M01C093G05 pDONR221 IMS10-A03 AK124332 ENST00000330825  
HGE117397 M01C093I05 pDONR221 IMS10-A03 AK124332 ENST00000330825  
HGE117445 M01C093K05 pDONR221 IMS10-A03 AK124332 ENST00000330825  
HGE117493 M01C093M05 pDONR221 IMS10-A03 AK124332 ENST00000330825  
HGE117541 M01C093O05 pDONR221 IMS10-A03 AK124332 ENST00000330825  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR188060 ARi70C12 pGCAP10 NR_024458.1  
AAACGAANAGCTCCCCCCGGGGAACGTGAGTATCAACCAAGAATGAATCTCGCTGTGTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl