Prev. | Human A to Z list > L > 

RIKEN DNA Bank Human Resource - LINC00240

Gene ID (NCBI) 100133205
Gene Symbol LINC00240
Protein Name long intergenic non-protein coding RNA 240
Synonyms C6orf41|NCRNA00240|bA373D17.1
Databases KEGG hsa:100133205 |  NCBI Gene 100133205


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR420679 RBdS051L15 pGCAP10 NR_026775.1  
GCCCAGGGATTCCCACCACCCGCACTCCACTCGCAGACGGCGGGCCTTCCTCCGACGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl