Prev. |  KEGG KO K18186 > 

RIKEN DNA Bank Human Resource - PET100

Gene ID NCBI Gene 100131801 |  KEGG hsa:100131801
Gene Symbol PET100
Protein Name PET100 cytochrome c oxidase chaperone
Synonyms C19orf79
Ortholog resources KEGG ortholog (KEGG orthology K18186) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR072551 ARe81G07 pKA1U5 NM_001171155.1  
GGTTGACCGGGAGAAACGAGATGGGGGTGAAGCTGGAGATATTTCGGATGATAATCTACC
HKR162951 ARi07G07 pGCAP10 NM_001171155.1  
GGGCTTTGGGCGGAACTGGCTTTGTTGACCGGGAGAAACGAGATGGGGGTGAAGCTGGAG
HKR249115 ARiS122N03 pGCAP10 NM_001171155.1  
GAGAAACGAGATGGGGGTGAAGCTGGAGATATTTCGGATGATAATCTACCTCACTTTCCC
HKR322169 RBb05H01 pKA1U5 NM_001171155.1  
ATCCTGGACTGGCTTTGTTGACCGGGAGAAACGAGATGGGGGTGAAGCTGGAGATATTTC
HKR327682 RBb19D10 pKA1U5 NM_001171155.1  
GGGGCGGAACTGGCTTTGTTGACCGGGAGAAACGAGATGGGGGTGAAGCTGGAGATATTT
HKR346521 RBb66F01 pGCAP1 NM_001171155.1  
GGTTTGTTGACCGGGAGAAACGAGATGGGGGTGAAGCTGGAGATATTTCGGATGATAATC
HKR373229 RBd33B05 pGCAP10 NM_001171155.1  
GGGCTTTGTTGACCGGGAGAAACGAGATGGGGGTGAAGCTGGAGATATTTCGGATGATAA
HKR374146 RBd35G02 pGCAP10 NM_001171155.1  
GGGGCGGAACTGGCTTTGTTGACCGGGAGAAACGAGATGGGGGTGAAGCTGGAGATATTT
HKR416302 RBdS040M14 pGCAP10 NM_001171155.1  
GGACCGGGAGAAACGAGATGGGGGTGAAGCTGGAGATATTTCGGATGATAATCTACCTCA
HKR428245 RBdS070K05 pGCAP10 NM_001171155.1  
GGGCTTTGTTGACCGGGAGAAACGAGATGGGGGTGAAGCTGGAGATATTTCGGATGATAA
HKR441898 RBdS104M10 pGCAP10 NM_001171155.1  
GAGAAACGAGATGGGGGTGAAGCTGGAGATATTTCGGATGATAATCTACCTCACTTTCCC
HKR462530 RBdS156F10 pGCAP10 NM_001171155.1  
GGAAACGAGATGGGGGTGAAGCTGGAGATATTTCGGATGATAATCTACCTCACTTTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl