Prev. | 

RIKEN DNA Bank Human Resource - USP30-AS1

Gene ID NCBI Gene 100131733 |  KEGG hsa:100131733
Gene Symbol USP30-AS1
Protein Name USP30 antisense RNA 1
Synonyms -
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068078 ARe70D06 pKA1U5 XM_001722340.1  
GGAGTGAAGGAACATGGCTCTGAATCATGCCTGTCTGTCTCCCCAGGTCTGTGCTTAAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl