Prev. | 

RIKEN DNA Bank Human Resource - NEMP2

Gene ID NCBI Gene 100131211 |  KEGG hsa:100131211
Gene Symbol NEMP2
Protein Name nuclear envelope integral membrane protein 2
Synonyms TMEM194B
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR389355 RBd73G11 pGCAP10 NM_001142645.2 Full/var done
GACTTCCGCTCCTCGCGGCGGAGCCGGTCCCCTAGGGCTCGGGTCGCACGGAGCTGACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl