Prev. | 

RIKEN DNA Bank Human Resource - SYCE1L

Gene ID NCBI Gene 100130958 |  KEGG hsa:100130958
Gene Symbol SYCE1L
Protein Name synaptonemal complex central element protein 1 like
Synonyms MRP2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR365350 RBd13G06 pGCAP10 NM_001129979.1  
GGGAGCGGCAGCTGCACTCGCCGCCTGAGGTCGAGGGCGCCATGGCGGTGAATGACGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl