Prev. | 

RIKEN DNA Bank Human Resource - SMIM6

Gene ID NCBI Gene 100130933 |  KEGG hsa:100130933
Gene Symbol SMIM6
Protein Name small integral membrane protein 6
Synonyms C17orf110|ELN
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY100554 IRAL051G10 pDNR-LIB BC062771 NM_001162997.2

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040545 ARe01G01 pKA1U5 NM_001162997.1  
GACACGTCACCCAGACAGAGGACAGCCCAGCCCAGCCACAGTTGCTTCTTTGAGTCAGGG
HKR165726 ARi14F06 pGCAP10 NM_001162997.1  
GACAACACAGGAAGTGAGCCCTACGCCAGTCCCAGCCCCAGGGCTTCCTGAGCTCGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl