Prev. | 

RIKEN DNA Bank Human Resource - HDHD5-AS1

Gene ID NCBI Gene 100130717 |  KEGG hsa:100130717
Gene Symbol HDHD5-AS1
Protein Name HDHD5 antisense RNA 1
Synonyms CECR4|CECR5-AS1|NCRNA00017
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055258 ARe38C10 pKA1U5 NR_024482.1 no cds done
GGTAGTCCTGTAAGCGCGCGGAGCCCGTCGGGCGCCTATGGAACTCGACCCGCAGGCCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl