RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - ZNF737

Gene ID	NCBI Gene 100129842 \| KEGG hsa:100129842
Gene Symbol	ZNF737
Protein Name	zinc finger protein 737
Synonyms	ZNF102

Ortholog resource in our bank

  ZNF737

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR342433	RBb56B09	pGCAP1	XR_042310.1
HKR342433	GGAGGACGGCTTTCTGGTATGGCGCGGCCTTTGTCTCTTGCTGCCGCTGGAGCTCCAGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl