Prev. | 

RIKEN DNA Bank Human Resource - SMIM27

Gene ID NCBI Gene 100129250 |  KEGG hsa:100129250
Gene Symbol SMIM27
Protein Name small integral membrane protein 27
Synonyms C9orf133|TOPORS-AS1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR393654 RBd84C06 pGCAP10 XM_001722063.1  
GAGCCACCGCCTGGGAGGTTACTGTAAGGCCCGCAGCTCCCGCCAGCTCCCGCGGACTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl