Prev. | 

RIKEN DNA Bank Human Resource - LINC01003

Gene ID NCBI Gene 100128822 |  KEGG hsa:100128822
Gene Symbol LINC01003
Protein Name long intergenic non-protein coding RNA 1003
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR347609 RBb69A09 pGCAP1 NR_027387.1 done
GGGGGCAGGCCTCGGGACACCTGCCTCCGCCGCCGGCCGCCGGCCGCCGTCCTCGCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl