Prev. | 

RIKEN DNA Bank Human Resource - NEBL-AS1

Gene ID NCBI Gene 100128511 |  KEGG hsa:100128511
Gene Symbol NEBL-AS1
Protein Name NEBL antisense RNA 1
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR209447 ARiS023K07 pGCAP10 XM_001716027.1  
GACGGGGAGGGCGACGGGGCCTGGCGCCTGGGGCCGGCCGCGCTCTCGGGCTCGCAGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl