Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NEBL-AS1

Gene ID (NCBI) 100128511
Gene Symbol NEBL-AS1
Protein Name NEBL antisense RNA 1
Synonyms -
Databases KEGG hsa:100128511 |  NCBI Gene 100128511


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR209447 ARiS023K07 pGCAP10 XM_001716027.1  
GACGGGGAGGGCGACGGGGCCTGGCGCCTGGGGCCGGCCGCGCTCTCGGGCTCGCAGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl