Prev. | 

RIKEN DNA Bank Human Resource - DNM1P35

Gene ID NCBI Gene 100128285 |  KEGG hsa:100128285
Gene Symbol DNM1P35
Protein Name dynamin 1 pseudogene 35
Synonyms DNM1DN8-2|DNM1DN8.2|DNM1DN8@|FKSG88
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR167601 ARi19A01 pGCAP10 NR_024595.1  
GGCTCATCGCTCCTCTTTCTGTTCCTGGCTCCCTTTCGCCCGCAGGTCGCCCAAGTCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl