Prev. | 

RIKEN DNA Bank Human Resource - C8orf88

Gene ID NCBI Gene 100127983 |  KEGG hsa:100127983
Gene Symbol C8orf88
Protein Name chromosome 8 open reading frame 88
Synonyms -
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR078124 ARe95F04 pKA1U5 XM_001722571.2  
GGGTCAGCCAGCGGACCAGCGGCAGGAGCCGTTCCCCGACGGGCAGCAGGGCGCTCGGCC
HKR172899 ARi32E03 pGCAP10 XM_001722571.2  
GTCTCTCGAGGCTCAGCGCCCGAGGCCACGCCCCGCGCCCGCCCTGGGCCCGCCTCGTGC
HKR182945 ARi57G01 pGCAP10 XM_001722571.2  
GGGACCAGCGGCAGGAGCCGTTCCCCGACGGGCAGCAGGGCGCTCGGCCTCCGCGTGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl