Prev. | 

RIKEN DNA Bank Human Resource - CSKMT

Gene ID NCBI Gene 751071 |  KEGG hsa:751071
Gene Symbol CSKMT
Protein Name citrate synthase lysine methyltransferase
Synonyms CS-KMT|METTL12|U99HG
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR219633 ARiS049B09 pGCAP10 NM_001043229.1  
GCTTTTTCGGAGGGTGGTGAGCTAGTAAGTGTGGTTTTAGCTGTAGTAGCCAGATTGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl