Prev. | 

RIKEN DNA Bank Human Resource - LOC730098

Gene ID NCBI Gene 730098 |  KEGG hsa:730098
Gene Symbol LOC730098
Protein Name uncharacterized LOC730098
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR474874 RBdS187D02 pGCAP10 XR_041278.2  
GCCGTTTCCGGGGTGGAGCCAGGGAGGGCGGGAGTTTAGGCTGCGCTGACCCCTCTCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl