Prev. | 

RIKEN DNA Bank Human Resource - UMAD1

Gene ID NCBI Gene 729852 |  KEGG hsa:729852
Gene Symbol UMAD1
Protein Name UBAP1-MVB12-associated (UMA) domain containing 1
Synonyms RPA3-AS1|RPA3OS
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE083205 M01C008A05 pDONR221 FLJ01-E03 AK027125  
HGE083253 M01C008C05 pDONR221 FLJ01-E03 AK027125  
HGE083301 M01C008E05 pDONR221 FLJ01-E03 AK027125  
HGE083349 M01C008G05 pDONR221 FLJ01-E03 AK027125  
HGE083397 M01C008I05 pDONR221 FLJ01-E03 AK027125  
HGE083445 M01C008K05 pDONR221 FLJ01-E03 AK027125  
HGE083493 M01C008M05 pDONR221 FLJ01-E03 AK027125  
HGE083541 M01C008O05 pDONR221 FLJ01-E03 AK027125  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR209366 ARiS023G22 pGCAP10 XR_040870.1  
GGTGTGAAGCTCCGGTGCTGGTGCGGCGGGGGACTGCGGGGCCAGCCTCAGGTAGCAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl