Prev. | 

RIKEN DNA Bank Human Resource - FAHD2CP

Gene ID NCBI Gene 729234 |  KEGG hsa:729234
Gene Symbol FAHD2CP
Protein Name fumarylacetoacetate hydrolase domain containing 2C, pseudogene
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR167728 ARi19F08 pGCAP10 NR_003698.1  
GAGTGACTTCGCCGCTGCTGTAGTTCCCCGGCTGGATGCGGTGACTGGTGCCAGTGCTCA
HKR420722 RBdS051N10 pGCAP10 NR_003698.1  
GAGCTGCTGCATTTCCCCGGCTGGCTGCGGTCACTGGTGGCAGTGCTCAGGCGCCCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl