Prev. | 

RIKEN DNA Bank Human Resource - OIP5-AS1

Gene ID NCBI Gene 729082 |  KEGG hsa:729082
Gene Symbol OIP5-AS1
Protein Name OIP5 antisense RNA 1
Synonyms cyrano|linc-OIP5
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR174003 ARi35A03 pGCAP10 XR_040994.1  
GAGGGTTGGCCACCTTGAGAAGCTGCGAAGATGGCGGAGTAAGGCGTGCCGCTGTAAACT
HKR420736 RBdS051N24 pGCAP10 XR_040994.1  
GAAGCTGCGAAGATGGCGGAGTAAGGCGTGCCGCTGCAAACTGGCCTCTGGGCCGGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl