Prev. | 

RIKEN DNA Bank Human Resource - FAM72D

Gene ID NCBI Gene 728833 |  KEGG hsa:728833
Gene Symbol FAM72D
Protein Name family with sequence similarity 72 member D
Synonyms GCUD2
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR406205 RBdS015I13 pGCAP10 NM_207418.2  
GGACAGACCCCAGCGCCGACTGAGCCTCTAAAGCGACTTCAGCTCTGCCCCACCAACACC
HKR461805 RBdS154I13 pGCAP10 NM_207418.2  
GGTGTTCGGTGACAGACCCCAGCGCCGACTGAGCCTCTAAAGCGACTTCAGCTCTGCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl