RIKEN DNA Bank Human Resource

Prev. | KEGG KO K19494 >

RIKEN DNA Bank Human Resource - DMRTC1B

Gene ID	NCBI Gene 728656 \| KEGG hsa:728656
Gene Symbol	DMRTC1B
Protein Name	DMRT like family C1B
Synonyms	-

Ortholog resource in our bank

  DMRTC1B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR408863	RBdS022C15	pGCAP10	NM_001080851.1
HKR408863	CGGCCGGCCGATGCCTCCCGCTTCTTCCTCCTCCTCCTCCTCCTCCTCCACCTCCANCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl