Prev. |  KEGG KO K11147 > 

RIKEN DNA Bank Human Resource - DHRS4L1

Gene ID NCBI Gene 728635 |  KEGG hsa:728635
Gene Symbol DHRS4L1
Protein Name dehydrogenase/reductase 4 like 1
Synonyms SDR25C4
Ortholog resource in our bank

  DHRS4L1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR177705 ARi44E09 pGCAP10 NM_001082488.1  
GGCCCTACTCTGTCACCTCGCTGGAAGGAGTGGAACCCAGACTTGCTGGTCTGATCCATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl