Prev. | 

RIKEN DNA Bank Human Resource - C12orf73

Gene ID NCBI Gene 728568 |  KEGG hsa:728568
Gene Symbol C12orf73
Protein Name chromosome 12 open reading frame 73
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY042647 IRAK106K07 pBluescript BC044618

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR325780 RBb14H12 pKA1U5 NM_001135570.1  
GGCTCGCCGNTCCGCTCCGNTCCGCCCTTAGACCCCTTTNNCAGCATCCCTGCAGATTCG
HKR333232 RBb33B08 pGCAP1 NM_001135570.1  
GGCGCGCCAGCCAGCCTGCCCAGCAGTGAGGGGCGCAAGGGAGGGGCGGCGCTGGCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl