Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - C12orf73

Gene ID (NCBI) 728568
Gene Symbol C12orf73
Protein Name chromosome 12 open reading frame 73
Synonyms -
Databases KEGG hsa:728568 |  NCBI Gene 728568


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR325780 RBb14H12 pKA1U5 NM_001135570.1  
GGCTCGCCGNTCCGCTCCGNTCCGCCCTTAGACCCCTTTNNCAGCATCCCTGCAGATTCG
HKR333232 RBb33B08 pGCAP1 NM_001135570.1  
GGCGCGCCAGCCAGCCTGCCCAGCAGTGAGGGGCGCAAGGGAGGGGCGGCGCTGGCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl