RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - DNLZ

Gene ID	NCBI Gene 728489 \| KEGG hsa:728489
Gene Symbol	DNLZ
Protein Name	DNL-type zinc finger
Synonyms	C9orf151\|HEP\|HEP1\|TIMM15\|ZIM17\|bA413M3.2

Ortholog resource in our bank

  DNLZ

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR066898	ARe67E02	pKA1U5	NM_001080849.1	Full
HKR066898	GCTTCCAAGATGGCGGCGGGGCGGGGCCGGGGCAGGGCGGACGGAGCCGGCGAGCGGGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv

2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl