Prev. |  KEGG KO K11251 > 

RIKEN DNA Bank Human Resource - H2AC19

Gene ID NCBI Gene 723790 |  KEGG hsa:723790
Gene Symbol H2AC19
Protein Name H2A clustered histone 19
Synonyms H2A/R|HIST2H2AA4
Ortholog resource in our bank

  H2AC19

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR461725 RBdS154F05 pGCAP10 NM_001040874.1  
GGATTTTGTTTGTTTTCTCGTGAGCTTAGGCTGCTGGTTTTGGTGATTTTTGTCTGATTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl