Prev. | 

RIKEN DNA Bank Human Resource - FAM86DP

Gene ID NCBI Gene 692099 |  KEGG hsa:692099
Gene Symbol FAM86DP
Protein Name family with sequence similarity 86 member D, pseudogene
Synonyms FAM86D
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064951 ARe62G07 pKA1U5 XR_017820.1 done
GATGGCGCCCGAGGAGAATGCGGGGACCGAACTCTTGCTGCAGAGTTTCGAGCGCCGCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl