Prev. | 

RIKEN DNA Bank Human Resource - PHLDB3

Gene ID NCBI Gene 653583 |  KEGG hsa:653583
Gene Symbol PHLDB3
Protein Name pleckstrin homology like domain family B member 3
Synonyms -
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR174554 ARi36G10 pGCAP10 NM_198850.3  
GCCCTGCCACCTGTCTCATAGGCAGAAGCGGCCGTGCCCAGCGCGCAGAGCGGAGCGCGC
HKR276639 ARiS191J23 pGCAP10 NM_198850.3  
GGCCCTGATGGAGCAGCGAGTGAAGGAGCTACAGCGCCAGAGGAAGGAGCTGAGGATCGA
HKR333679 RBb34D07 pGCAP1 NM_198850.3  
GCCCCAGCGGCCATGGGGACGCGAAGCAGCCCCGAGGAGGGGACCCCGCCGCCGCTGGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl