Prev. | 

RIKEN DNA Bank Human Resource - KIAA0895L

Gene ID NCBI Gene 653319 |  KEGG hsa:653319
Gene Symbol KIAA0895L
Protein Name KIAA0895 like
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR387627 RBd69B03 pGCAP10 NM_001040715.1 Full done
GATTCATTATGCACCCAGTGCTGGGTGCTTGGTACACGGGGGTGAATCAGACCCCATTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl