Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ABCA17P

Gene ID (NCBI) 650655
Gene Symbol ABCA17P
Protein Name ATP-binding cassette, sub-family A (ABC1), member 17, pseudogene
Synonyms ABCA17
Databases KEGG link 01 |  NCBI Gene link 01


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR470858 RBdS177C10 pGCAP10 NR_003574.1
GACACCCGGAAACTCGACTTTGGCCGTTTCTCCATTTCTCCTCACGCACTGTCTTTCCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl