Prev. | 

RIKEN DNA Bank Human Resource - ABCA17P

Gene ID NCBI Gene 650655 |  KEGG hsa:650655
Gene Symbol ABCA17P
Protein Name ATP binding cassette subfamily A member 17, pseudogene
Synonyms ABCA17
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR470858 RBdS177C10 pGCAP10 NR_003574.1  
GACACCCGGAAACTCGACTTTGGCCGTTTCTCCATTTCTCCTCACGCACTGTCTTTCCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl