Prev. | 

RIKEN DNA Bank Human Resource - DLGAP1-AS1

Gene ID NCBI Gene 649446 |  KEGG hsa:649446
Gene Symbol DLGAP1-AS1
Protein Name DLGAP1 antisense RNA 1
Synonyms HsT914
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE083231 M01C008B07 pDONR221 FLJ01-G04 AK093095 NM_001039796  
HGE083279 M01C008D07 pDONR221 FLJ01-G04 AK093095 NM_001039796  
HGE083327 M01C008F07 pDONR221 FLJ01-G04 AK093095 NM_001039796  
HGE083375 M01C008H07 pDONR221 FLJ01-G04 AK093095 NM_001039796  
HGE083423 M01C008J07 pDONR221 FLJ01-G04 AK093095 NM_001039796  
HGE083471 M01C008L07 pDONR221 FLJ01-G04 AK093095 NM_001039796  
HGE083519 M01C008N07 pDONR221 FLJ01-G04 AK093095 NM_001039796  
HGE083567 M01C008P07 pDONR221 FLJ01-G04 AK093095 NM_001039796  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072430 ARe81B06 pKA1U5 NR_024101.1  
GGCGCAGGCAATCCACAGCAGCTGCCCCTGCAAATGTCAGCGCCAGCCCAGTCAAAAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl