Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NIPBL-AS1

Gene ID (NCBI) 646719
Gene Symbol NIPBL-AS1
Protein Name NIPBL antisense RNA 1 (head to head)
Synonyms NIPBL-AS
Databases KEGG hsa:646719 |  NCBI Gene 646719


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR322553 RBb06G09 pKA1U5 XR_041070.1  
GCGGGCCCAGCAGCCGGGAGGCGGCAGCTCTCCTCTACGCCCGTCCCCTCAGGGCGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl