Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AC058791.1

Gene ID (NCBI) 646329
Gene Symbol AC058791.1
Protein Name uncharacterized LOC646329
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR171297 ARi28E01 pGCAP10 XM_935369.3  
GATCAGAATTTCTCAAGATCAAAACGAAACCTTCTCTTTAAAAAGGAAAGAAAGTACTAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl