Prev. | 

RIKEN DNA Bank Human Resource - PDCD6IPP2

Gene ID NCBI Gene 646278 |  KEGG hsa:646278
Gene Symbol PDCD6IPP2
Protein Name PDCD6IP pseudogene 2
Synonyms -
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR380009 RBd50A09 pGCAP10 XR_042308.2  
GCTGGCGGCGCCTGAGCCAGCGGCTGCTAGGAGGCTGTGTCCGCAAGCCAGCGGGGCGAG
HKR380177 RBd50H09 pGCAP10 XR_042308.2  
GGAGCCAGCGGCTGCTAGGAGGCTGTGTCCGCAAGCCAGCGGGGCGAGGCGCCTGGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl